For Mac Command Shift O Raj Suvariya Medium

Micro-organisms inhabiting animal guts benefit from a protected and nutrient-rich environment while assisting the host with digestion and nutrition. In this study we compare, for the first time, the bacterial and fungal gut communities of two species of the small desert dung beetle genus Pachysoma feeding on different diets: the detritivorous P. Endroedyi and the dry-dung-feeding P. Whole-gut microbial communities from 5 individuals of each species were assessed using 454 pyrosequencing of the bacterial 16S rRNA gene and fungal ITS gene regions. The two bacterial communities were significantly different, with only 3.7% of operational taxonomic units shared, and displayed intra-specific variation.

The number of bacterial phyla present within the guts of P. Endroedyi and P. Striatum individuals ranged from 6–11 and 4–7, respectively. Fungal phylotypes could only be detected within the gut of P. Although the role of host phylogeny in Pachysoma microbiome assembly remains unknown, evidence presented in this study suggests that host diet may be a deterministic factor.

Introduction The microbial gut communities of a wide range of insect species have been investigated (for reviews see –). The gut environment is considered to be an unstable system, as microorganisms face secretion of digestive enzymes, physical disturbance, habitat shedding during insect moults and other physiochemical conditions that are typically unfavourable for colonisation ,. However, there are significant benefits to gut colonisation, including high nutrient availability and protection from external environmental stressors ,. The relationships between host and gut microbiota range across the full spectrum of interactions; i.e., from pathogenic to obligate mutualism. When beneficial to their host, insect-associated microbial communities may participate in a number of activities including degradation of recalcitrant materials such as lignocellulose –, the production of nutrients and vitamins , , the production of components of cohesion pheromones , nitrogen fixation and utilisation of nitrogenous waste products , , protection against parasites , , change in body colouration and sterol synthesis ,.

Wireless Protocols for Internet of Things: Part I – Wireless Personal Area Networks Raj Jain Washington University in Saint Louis Saint Louis, MO 63130 Jain@cse.wustl.edu. PAN Id and Addr no present. 16-bit short address. 64-bit extended address. Sathyandranath Ragunanan 'Mac' Maharaj (born 22 April 1935 in Newcastle, KwaZulu-Natal) is a South African politician affiliated with the African National Congress.

Insect gut microbiomes are known to differ between insect species, driven by variations in the gut structure, different host lifecycles, host phylogeny and diet ,. The gut microbiome is also influenced within the individual insect or species, varying according to host life-stage –, and/or diet , –. Host diet influences gut microbial communities as they adapt to dietary changes through the induction of enzymes and changes in community structure ,.

However, a core community may persist through major dietary changes ,. Studies on insect-microbial associations have mainly focused on termites , –, but also on agriculturally important species such as honeybees , , and medically important insects such as mosquitoes , –. Little attention has been given to dung beetles, which are common and abundant insects in virtually all terrestrial environments and which facilitate nutrient cycling and bioturbation. The desert dung beetle genus Pachysoma MacLeay, from the Scarabaeini tribe, of which the quintessential scarab genus, Scarabaeus is also a member, consists of 13 species endemic to the south-west African coast ,.

Members of Pachysoma exhibit atypical feeding behaviour. While most adult dung beetles feed, by filtration, on minute particulate fragments in wet dung , , adult Pachysoma feed on various and varying dry food sources: plant detritus, dung pellets or both.

These substrates are collected on the soil surface and masticated with specially-adapted mouthparts (; , ). Cytochrome oxidase I gene Parsimony tree phylogeny of 13 Pachysoma spp. Branch colours indicate the diet of the Pachysoma spp.: dung (brown), plant detritus (green), polyphagous (blue) and unknown (no colour).

This phylogentic tree was adapted, with permission, from and the dietary information taken from both and personal observations by Prof C. Two species of Scarabaeus, ( S.

Proboscideus and S. Rugosus) which is the sister-genus to Pachysoma and a typical wet-dung-feeder, were used as outgroups.

Numbers to the right of the tree indicate the three Pachysoma lineages. The two species considered in this study, P. Endroedyi and P. Striatum, are indicated with stars (Adapted from C. Given that insect gut microorganisms are known to be involved in the degradation of recalcitrant materials such as lignocellulosic compounds , ), it follows that the gut microbiomes of desert insects may play a significant role in carbon-turnover in desert ecosystems. By studying the gut microbiome diversity of Pachysoma spp.

Feeding on different plentiful and readily-available substrates, it is possible to consider the effects of host diet and/or host phylogeny on gut microbiome assembly processes. This study was designed to characterise the gut microbial (bacterial and fungal) assemblages of coprophagous ( P. Striatum) and detritivorous ( P. Endroedyi; pers. Scholtz) members of the same genus from the same location and to potentially determine whether host diet and/or host phylogeny could be deterministic factors in Pachysoma gut microbial community assembly. The desert beetle genus Pachysoma The distribution of the Pachysoma species is restricted to the arid coastal regions of south-western Africa, principally because of the flightless nature of the genus.

The genus Pachysoma forms three distinct lineages, supporting six (lineage 1), four (lineage 2) and three (lineage 3) species, respectively. Pachysoma endroedyi is located in lineage 1 and P. Striatum in lineage 2. The driving forces behind the formation of these three lineages are currently unknown. However, it has been noted that all members of lineage 3 have a uniform diet and originate from desert areas with a consistent aridity index , , whereas both the aridity index of the desert locations from which lineage 1 and 2 members originate, and their diets, fluctuate. The diet of P.

Striatum consists predominantly of the dry dung pellets of various small native mammalian herbivores and sheep. Despite observations from a decade ago stating that P. Endroedyi was a polyphagous feeder , numerous and wide-scale recent observations suggest that P. Endroedyi is a detrivore (Prof C. Scholtz, pers.

Comm.), the classification adopted in this study. Pachysoma species have specialised anatomical and physiological features for mastication and digestion of fragments from plant detritus and dry dung ,. The linkage between host and gut microbiome is believed to be bidirectional, in that gut microorganisms can provide nutritional assistance to the insect host while the host diet influences the gut microbiome assembly , –. However, host phylogeny may also impact gut microbiome composition , , irrespective of the diet.

Sequencing outputs and diversity indices of the bacterial 16S rRNA gene and fungal ITS region of the Pachysoma gut microbiome The gut microbiomes of five detritivorous P. Endroedyi and five coprophagous P. Striatum individuals were determined by 16S rRNA gene amplicon sequencing. After removal of chimeras and singletons, 39050 bacterial and 1492 fungal reads remained, with mean read lengths of 238bp and 100bp, respectively. Only 462 bacterial reads were obtained for P. Endroedyi individual 3 , which was therefore removed from further analysis. Considerable variation in the number of bacterial sequence reads was noted between individuals, ranging from 1718 to 2817 and 3911 to 10106 for P.

Endroedyi and P. Striatum, respectively. However, Good’s coverage (0.97 for all samples), rarefaction and chao1 diversity indices suggested that the coverage of Pachysoma bacterial gut communities were sufficient for a valid comparison between individuals. The fungal ITS gene region could not be amplified in samples from the detritivorous species P. Endroedyi, despite repeated attempts. The absence of fungi in the insect gut has previously been noted for individuals of various insect groups including Neuroptera and Coleoptera (using culture-dependent techniques: ). In the fungal ITS sequence datasets for P.

Striatum, diversity indices and rarefaction curves showed low coverage for all but P. Striatum individual 2, suggesting that the fungal diversity was generally underestimated (; ). Individual Number of reads Number of OTUs Phyla Singletons Chao Invsimpson Shannon Coverage Bacterial 16S rRNA gene P. Endroedyi 1 2120 213 10 105 244.61 19.01 3.88 0.97 Bacterial 16S rRNA gene P. Endroedyi 2 1718 258 11 133 282.34 81.00 4.91 0.97 Bacterial 16S rRNA gene P. Endroedyi 3 462 97 11 42 112.62 21.47 3.82 0.94 Bacterial 16S rRNA gene P. Endroedyi 4 2175 271 6 177 287.59 62.44 4.80 0.98 Bacterial 16S rRNA gene P.

Endroedyi 5 2817 317 9 193 335.83 60.13 4.83 0.98 Bacterial 16S rRNA gene P. Striatum 1 10106 157 4 84 174.53 8.77 2.82 1.00 Bacterial 16S rRNA gene P. Striatum 2 4901 158 4 87 194.96 16.64 3.38 0.99 Bacterial 16S rRNA gene P. Striatum 3 4208 140 6 51 183.05 8.36 2.88 0.99 Bacterial 16S rRNA gene P.

Striatum 4 3911 119 4 71 125.84 8.12 2.93 1.00 Bacterial 16S rRNA gene P. Striatum 5 6620 172 5 100 201.29 13.36 3.32 0.99 Fungal ITS gene region P. Striatum 1 136 88 1 156 179.50 96.63 4.29 0.55 Fungal ITS gene region P. Striatum 2 939 202 2 602 222.81 51.93 4.56 0.94 Fungal ITS gene region P. Striatum 3 199 106 2 223 248.38 88.35 4.40 0.66 Fungal ITS gene region P. Striatum 4 107 70 2 153 157.50 65.94 4.04 0.53 Fungal ITS gene region P.

Striatum 5 111 63 2 146 134.75 52.18 3.88 0.62. A total of 1009 bacterial and 294 fungal OTUs were detected at an identity threshold of 97%.

Numbers ranged from 213 to 317 and 119 to 172 in the P. Endroedyi and P. Striatum gut samples, respectively. These values are comparable with results obtained for termite and cockroach gut microbiomes.

It should be noted that the fungal ITS sequence read lengths were short (only 100bp), which could explain the poor phylogenetic resolution of P. Striatum fungal gut communities.

In both Pachysoma spp., the number of bacterial 16S rRNA sequence reads was inversely proportional to the number of bacterial OTUs; i.e., P. Striatum gut samples had a higher average number of bacterial reads (5949 ± 2550) but a lower average number of bacterial OTUs (149 ± 20) when compared to P. Endroedyi (2208 ± 455 reads and 265 ± 43 OTUs, respectively). Those data suggest that the gut bacterial communities of P. Striatum are composed of a relatively low number of dominant phylotypes at high abundance ,.

Contrastingly, the P. Endroedyi gut bacterial community may include a higher bacterial diversity ,. This inverse relationship, and the higher Shannon diversity index of the P. Endroedyi gut bacterial community (4.6 ± 0.5) compared with the P. Striatum gut community (3.1 ± 0.3; ), suggests that competition is greater in the P.

Striatum gut than in P. This difference may be a reflection of the different diets, as insects feeding on simple diets (e.g., the coprophagous diet of P. Striatum) commonly have a lower gut bacterial diversity than those feeding on more complex diets (e.g., the detritivorous diet of P. Endroedyi , ). Interspecific variations in bacterial and fungal Pachysoma gut communities The gut bacterial communities of P.

Endroedyi and P. Striatum were significantly different, sharing only 3.7% of bacterial OTUs (; ANOSIM R = 1.00, p. NMDS ordination plot based on Bray-Curtis distance matrices of bacterial 16S rRNA gene pyrosequencing data for P. Endroedyi and P. Striatum individuals. A stress value of less than 0.1 represents a high quality ordination. Pachysoma endroedyi and P.

Striatum are represented by green and inverted brown triangles, respectively. It is not possible to compare the gut fungal communities of the two insect species studied, given that despite numerous attempts we were unable to PCR-amplify fungal ITS sequences from the detritivorous P. While we think it unlikely that fungal species are completely absent from the gut microbiome of this species, this negative result suggests that they may represent a relatively minor fraction of the total gut microbial diversity.

To fully confirm this, the sample size should be increased and P. Endroedyi individuals from multiple breeding populations should be investigated. We would expect host diet to be a contributing factor in the presence (or absence) of fungi in the Pachysoma gut.

For example, true yeasts (Saccharomycetes) are typically observed in the guts of litter-, plant- and wood-feeding insects –, but not in those of predacious insects ,. Intraspecific variation of Pachysoma gut microbial communities Large intraspecific differences in Pachysoma gut communities were noted, with the majority of OTUs being unique to each Pachysoma individual (, ) and only 11 (1.1%) and 17 (3.3%) bacterial OTUs being shared between individuals of P. Endroedyi and P.

Striatum, respectively. Furthermore, only two non-abundant fungal OTUs (ranging from 1.6–1.7% of the community) were shared among the five P. Striatum individuals. Such intraspecific differences, relating to the relative abundances and diversity of bacterial members of gut communities, are not uncommon, as has been observed for honeybees ( Apis cerana and A. Mellifera ), mosquitoes ( Aedes spp., Culex spp., Anopheles spp., Mansonia spp.; , ) and the red palm weevils Rhynchophorus ferrugineus and R.

Vulneratus , among others. Leather folio sleeve case cover for mac. A recent study on the gut microbiomes of 218 different insect species from 21 orders indicated that 46% of the total number of bacterial OTUs detected (n = 9301) were only observed in single individuals.

The large intraspecific variation noted in Pachysoma could be influenced by the stochastic, and transient, process of microorganisms entering the gut with the food source and, for P. Striatum, the different amounts of feeding material contained in the guts of each individual. Furthermore, it cannot be excluded that the ‘time of feeding’ prior to sampling may also have had an influence on intraspecific gut microbiome variability. A) Venn diagram comparing the distribution of fungal OTUs between P. Striatum individuals based on the ITS gene region pyrosequencing analysis and (b) relative abundance of fungal phyla in five P. Striatum individuals based on ITS rRNA gene region pyrosequencing analysis at a 97% identity threshold. Shared OTUs in the Venn diagram are shown in bold with numerical labels given for each individual.

Of the shared bacterial OTUs, only one (assigned to the phylum Bacteroidetes) and eight (4 Firmicutes, 2 Actinobacteria, 1 Bacteroidetes and 1 Proteobacteria) were abundant (i.e., represented 2% reads) in the P. Endroedyi and P. Striatum gut samples, respectively. This distribution is strongly suggestive that the Pachysoma gut core community is very small, as has been proposed for the “minimal core” model. Other studies have noted the presence of consistent core microbial communities within individuals of the same insect species (e.g., the bed bug Cimex lectularius; and bumble bee Bombus terrestris , ), or across taxonomic levels (e.g., across the ant tribe Cephalotini; ). In the termite Reticulitermes flavipes, a substantial core bacterial microbiome (65% shared OTUs) was noted, regardless of the artificial feeding diet, suggesting that host phylogeny may play a more important role than host diet in the assembly of the gut microbiome. Similar results have been noted in cockroaches.

However, with a minimal core microbiome in both Pachysoma spp., phylogeny appears less important than diet. Furthermore, a minimal core gut microbiome may result from negative interactions between gut microorganisms, such as antagonism or amensalism, or indicate, as for Drosophila , the establishment of ‘non-gut-specific’ microorganisms. It has been suggested that a ‘functional’ rather than a ‘phylogenetic’ core microbiome may be more informative in determining the assembly of gut microbiomes. In studies on humans, which typically follow the minimal core model, functional gene diversity appears to be broadly similar across individuals ,. Therefore, there may be a functional core community in each Pachysoma spp. Studied, displaying shared metabolic capacities ; i.e., exhibiting functional redundancy.

As such, it has been suggested that a comparison of functional properties of hosts feeding on different diets can guide an understanding of the functional roles of different gut microbiomes. Phylogenetic diversity of bacterial and fungal Pachysoma gut communities The gut bacterial diversity of P. Endroedyi was higher (6–11 phyla; ) than that of P. Striatum (4–7 phyla; ). Endroedyi gut samples were dominated by Bacteroidetes (18.0–54.8%), Firmicutes (10.0–34.6%), Proteobacteria (8.7–18.1%) and Planctomycetes (2.5–25.7%), while Actinobacteria (0.1–22.5%), Elusimocrobia (0–9.3%) and Synergistetes (0–7.3%) showed highly variable abundances. The remaining 7 phyla each represented less than 2% of the community and were often detected in single insects. Striatum, Bacteroidetes (3.0–57.1%), Firmicutes (18.9–56.2%), Proteobacteria (6.4–32.1%) and Actinobacteria (5.2–21.0%) were also dominant phyla although the relative abundances varied between individuals.

For Mac Command Shift O Raj Suvariya Medium Hairstyles

Three minor phyla (. Comparison of interspecific differences in relative abundance of bacterial phyla in the gut of two Pachysoma spp., P. Endroedyi and P. Striatum, based on 16S rRNA gene pyrosequencing analysis.

The presence of specific bacterial phyla and/or their relative abundances in insect gut samples may be linked to host diet. For example, certain insects with simpler diets (e.g., feeding on pollen and nectar , fruit , , or sap ), contain gut bacterial communities which are typically dominated by heterotrophic Proteobacteria and/or Firmicutes. In contrast, Bacteroidetes (along with other phyla) were highly abundant in the gut microbiomes of insects feeding on plant materials such as wood and leaves ,. Striatum gut bacterial communities did not display these patterns, suggesting that coprophagous diets may structure insect gut communities differently. Fifteen and 11 bacterial genera were abundant (2% relative abundance of reads) within the guts of P.

Endroedyi and P. Striatum, respectively. Only two of these genera were abundant in both species ( Dysgonomonas and unclassified Enterobacteriaceae; ). Dysgonomonas was less abundant in P.

Endroedyi gut samples (2.8% ± 0) than in P. Striatum (26.3% ± 0.2), in which it was the most abundant genus. Dysgonomonas have been reported to be present at high abundance in the gut system of the fungus-growing termite ( Macrotermes annandalei) and red palm weevil larvae ( Rhynchophorus ferrugineus) ,. Two species of Dysgonomonas have previously been characterised from the gut of termites ,. Both species have been found to ferment glucose and xylan as a sole carbon source and to produce acetic acid as the major end-product , , suggesting roles in both the lignocellulosic biomass degradation pathway and in providing readily metabolisable substrates for ingestion by the host. The large difference in the abundance of this phylotype in the two Pachysoma species suggests a key nutritional role in P. Striatum but not in P.

Phylum Family Genus P. Endroedyi (%) P. Percentages are the average read relative abundances in each species ( P. Endroedyi: n = 4; P.

Striatum: n = 5). Colours depict the species in which the bacterial genus is abundant: P. Endroedyi (green), P. Striatum (brown) or both (blue). The most abundant genus of each species is shown in bold.

An unclassified Planctomycetes dominated the gut samples of P. Endroedyi (11.3% ± 0.1 relative abundance of reads). To the best of our knowledge this is the first report of an insect gut microbiome dominated by Planctomycetes. Planctomycetes were only detected in a single P. Striatum individual at very low abundance (0.01%). Planctomycetes have previously been detected in the guts of the termites Syntermes wheeleri and Nasutitermes spp. , , the cockroach Shelfordella lateralis , adult and larval beetles ( Cryptocephalus spp., Prionoplus reticularis and Pachnoda spp.; –), the tree weta Hemideina thoracica and the mosquito Aedes albopictus , but only in low abundances (.

Conclusion This is the first study to investigate the gut microbiomes of any dung beetle feeding on dry food sources and to compare those of closely related adult dung beetle species with very different diets but from the same locality. Pachysoma spp. Are ecologically important in arid environments where they undoubtedly participate in nutrient cycling and bioturbation. We have demonstrated that, as predicted, the gut microbiomes differed significantly between two species which feed on different substrates. However, both populations showed large intraspecific variations.

Raj

Thus, to further characterise the gut microbiomes of these Pachysoma species, the number of individuals studied should be increased and populations from different sites investigated. Such experiments would make it possible to evaluate whether interspecific variation was higher than intraspecific variation within a single Pachysoma species. We are unable to fully assess whether host phylogeny or the host diet is the dominant driver of the Pachysoma gut microbiomes. Nevertheless, we provide evidence that diet probably plays a significant role, particularly noting the fact that the gut microbiomes of the detritivorous P. Endroedyi (feeding on complex food sources) have higher bacterial diversities than those of the coprophagous species (feeding on relatively simple food sources) ,. Functional gene analysis of the microbiomes of P.

Endroedyi and P. Striatum could potentially assist in confirming the role that host diet plays in Pachysoma gut microbiome assembly. Collection and storage of Pachysoma spp Five adult individuals of P. Endroedyi and of P. Striatum from single breeding populations, feeding on plant detritus and dung respectively, were collected by the Scarab Research Group in September and October 2014 from coastal sandveld near Kommandokraal, Namaqualand, South Africa (S31°29'58.4' E18°12'29.2') under the Cape Nature permit number 0056-AAA008-00041. Ethical clearance is not necessary for work carried out on insects.

Beetles were identified at the site. Due to their size, 99% ethanol was injected into their abdomens using sterile syringes for gut preservation.

Insects were then stored in 99% ethanol at -80°C, until dissection. Gut dissection Gut dissections were performed under a Zeiss Stemi 2000-C dissection microscope (Zeiss, Oberkochen, Germany) as previously described with minor modifications. All equipment was sterilised before use with 10% bleach and 70% EtOH. The average body length of P. Endreodyi ranges from 20.7–26.4mm, and the one of P. Striatum 19 mm.

The insects were placed in a wax-lined glass Petri dish with quarter strength autoclaved Ringer solution (0.12 g/L CaCl 2, 0.105 g/L KCl, 0.05 g/L NaHCO 3, 2.25 g/L NaCl; Sigma-Aldrich). The thorax and abdominal integument were removed using scissors before pinning the specimen to the wax layer in the Petri dish. Forceps were used to remove the membranes covering the internal organs. The rectum was pulled downwards, moving the gut gently out of the body cavity. Endroedyi guts appeared full of diet material while the P. Striatum ones were empty (n = 1), half-full (n = 1) or full (n = 3). Hindgut and midgut samples were separated and stored in 1.5ml eppendorf tubes at -20°C until DNA extraction.

Metagenomic DNA extraction Gut-section metagenomic DNA extractions were performed using a modified version of the protocols previously described by ,. Whole-guts were weighed and crushed in liquid nitrogen using sterile mortars and pestles. For 10mg of gut, 100μl of a preheated (60°C) 2% CTAB solution (0.1M Tris HCl pH8.0, 1.4M NaCl, 0.02M EDTA pH8.0) was added. The mixtures were incubated for 30min at 60°C before centrifugation for 5min at 10000rpm. The supernatant was transferred to a clean collection tube and enzymatic digestion of the gut samples was carried out with the addition of 2μl lysozyme (5mg/ml) per 100μl CTAB solution for 30min at 37°C under continuous shaking (120 rpm).

0.5μl Proteinase K (20mg/ml) per 100μl CTAB was then added , followed by an overnight incubation at 55°C with continuous shaking. One volume phenol:chloroform:isoamyl alcohol (25:24:1) solution was added. Tubes were inverted and centrifuged at 13000rpm at 4°C for 4min. One volume chloroform:isoamyl alcohol (24:1) solution was added to the top aqueous phase and the mixtures were inverted before centrifugation at 13000rpm at 4°C for 15min. This step was repeated until no protein contamination was observed. DNA was precipitated with 3M NH 4Ac and ice cold 99.9% EtOH followed by overnight incubation at -20°C. Mixtures were centrifuged for 60min at 14000rpm at 4°C.

The DNA pellet was washed twice with ice cold 70% EtOH and allowed to dry completely for 2 hours. The DNA pellet was resuspended in 50μl filter-sterilized nanopure H 2O overnight at 4°C , and stored at -20°C for downstream analysis. 454 pyrosequencing of the bacterial 16S rRNA gene and fungal ITS gene region The gut metagenomic DNA of five individuals (equal concentrations of combined hindgut and midgut-derived DNA) from each Pachysoma spp. Was sent to Molecular Research for 16S rRNA gene and ITS gene region pyrosequencing using the Roche 454 GS FLX titanium platform. The primers 27F (AGRGTTTGATCMTGGCTCAG; ) and 338R (AGTGCTGCCTCCCGTAGGAGT; were used to amplify the 16S rRNA gene region as they have a low eukaryotic coverage (27F: 0%; 338R: ). Fungal specific fITS9 (GAACGCAGCRAAIIGYGA; ) and ITS4 (TCCTCCGCTTATTGATATGC; ) primers were used for the amplification of the ITS gene region. Data analysis Raw pyrosequencing reads were filtered and analysed using MOTHUR version 1.35.1 (Accessed May 2015- January 2016; ,.

In short, fasta, quality and flow files were extracted from the sff files using the sff.info command. For the bacterial 16S rRNA gene pyrosequencing reads, filtering of poor quality reads was done using the shhh.flows command allowing for reads to have one or two mismatches between the barcodes and primers respectively. Remaining sequences were quality filtered with the trim.seqs command to maximum homopolymers of 8bp and a minimum sequence length of 100bp. Sequences were aligned to the SILVA reference database using the align.seqs command. The screen.seqs and filter.seqs commands were used to retain only overlapping sequences. Chimeras were identified and removed using the chimera.uchime command. Sequences were classified against five databases, namely the Ribosomal Database Project (RDP), SILVA, NCBI, The Dictyoptera gut microbiota reference Database (DictDb; data shown) and GreenGenes with a confidence threshold of 80%.

OTUs were clustered for each individual beetle before removal of singletons using the remove.rare command. Samples were subsampled 1718 reads, i.e., the lowest number of reads across all samples. ITS reads were analysed similarly to that of the 16S reads with minor differences as outlined previously.

Filtering of poor quality reads was done using the trim.seqs command allowing for reads to have one or four mismatches between the barcodes and primers respectively. Sequences were trimmed to 200bp using the chop.seqs command to ensure all sequences were the same length. Sequences were classified against the UNITE database (Version 6) with a confidence threshold of 50% and subsampled to the lowest number of OTUs across all samples (107) for statistical analyses.

Phylogenetic comparisons, of both the bacterial and fungal datasets, were done using the relative abundance of all reads in the dataset so as to ensure inclusion of rare taxa. Relative abundances (%) were calculated from the number of reads of the microbial organism(s) in question divided by the total number of reads for the particular Pachysoma individual. Nucleotide sequences for both the bacterial and fungal datasets have been uploaded to NCBI Short Read Archive (SRA) under the accession number SRP071915. Statistical Analysis Two-dimensional Non-Metric Multi-Dimensional Scaling (nMDS) plots were constructed in Primer 6 software (version 6.1.5.81 (Primer E Ltd, Plymyth, UK)) after applying square-root pre-treatment and using the Bray-Curtis coefficient to build a dissimilarity matrix.

Kruskal’s stress value was used to determine the efficiency of sample placement in both two- and three-dimensional nMDS plots. Significant differences in bacterial gut communities were determined using one-way global Analysis of Similarities (ANOSIM) in Primer 6 software version 6.1.5.81 (Primer E Ltd, Plymyth, UK) using 10 000 permutations. A Venn plot was created using R (2.15.1) to differentiate between unique and shared OTUs dependent on feeding strategy. Diversity indices and rarefaction curves were generated in Mothur. Singletons were removed prior to analyses.

CONNECTIVITY Wi-Fi: 802.11 b/g/n Bluetooth: BT 4.1 with BLE GPS: Yes USB Connectivity: USB 2. JioPhone Monsoon Hungama Offer is a special offer from Jio in which you can exchange your existing phone for a brand new JioPhone at an effective price of Rs.

You just need to take your existing phone and charger which should be undamaged and in working condition, to your nearest Jio Retailer and pay Rs. 501 as refundable security deposit. You will also get a special JioPhone Recharge Plan of Unlimited Voice & Data for 6 months on paying only Rs 594 at the time of activation. Additionally you will also get a special exchange bonus of 6GB data voucher, worth Rs 101. You will get a total of 90 GB data over 6 months. JioPhone comes with a Jio SIM.

You may also port-in your existing number via MNP process. What is JioPhone Monsoon Hungama Offer? JioPhone Monsoon Hungama Offer is a special offer from Jio in which you can exchange your existing phone for a brand new JioPhone at an effective price of Rs. You just need to take your existing phone and charger which should be undamaged and in working condition, to your nearest Jio Retailer and pay Rs.

For Mac Command Shift O Raj Suvariya Medium Haircuts

501 as refundable security deposit. You will also get a special JioPhone Recharge Plan of Unlimited Voice & Data for 6 months on paying only Rs 594 at the time of activation. Additionally you will also get a special exchange bonus of 6GB data voucher, worth Rs 101. You will get a total of 90 GB data over 6 months. JioPhone comes with a Jio SIM. You may also port-in your existing number via MNP process. How much upfront payment do I need to make for the JioPhone Monsoon Hungama Offer?

As part of JioPhone Monsoon Hungama Offer, you need to make an upfront payment of Rs. 501 as refundable security deposit for new JioPhone. You will also get a special JioPhone Recharge Plan of Unlimited Voice & Data for 6 months on paying only Rs 594 at the time of activation. Additionally you will also get a special exchange bonus of 6GB data voucher, worth Rs 101. You will get a total of 90 GB data over 6 months. Reliance Retail Limited (“the Company”) offers to the applicant (“Recipient”), “JioPhone Monsoon Hungama offer” (“Offer”) effective on and from 20 th July, 2018 (as per specifications and together with specified accessories as provided on company website ‘www.jiophone.com’) on the terms and conditions as specified at www.jiophone.com. The Recipient acknowledges that the Recipient has a choice to avail the JioPhone either (i) by depositing a sum of Rs.

1500/- in the manner specified at www.jiophone.com; or (ii) under this Offer. By applying for the Offer and affixing an electronic or physical signature, the Recipient hereby signifies acceptance of all terms and conditions as stated herein. Eligibility for Offer. The Offer is eligible only to such Recipient who:. Deposits an interest-free refundable security deposit of Rs. 501/- (Rupees Five Hundred and One only) in accordance with Clause 3 below; and. Pays to the Company an amount of Rs.

495/- (Rupees Four Hundred and Ninety Five only) for electronic vouchers; and. Is a subscriber of the telecommunication services of an “Authorised Carrier” as on the date of issuance of the JioPhone in terms of the Offer, whether by way of a fresh subscription or successful porting to the services of an Authorised Carrier by availing the mobile number portability option available with such Recipient; and. Pays to the Company or its authorized retailer Rs. 99/- (Rupees Ninety Nine only) for the first month of usage of the JioPhone under the Offer; and.

Delivers to the Company, subject to Clause 2 below, a feature phone out of the phones listed at Annexure A, including its accessories, in such condition as may be found acceptable by the Company and delivered at such place and manner as may be prescribed by the Company from time to time (collectively “Feature Phone”). The decision of the Company with respect to the acceptance or rejection of the Feature Phone shall be final and binding upon the Recipient; and. Agrees to adhere to the terms and conditions of this Offer. Reliance Retail Limited (“the Company”) offers to the applicant (“Recipient”), JioPhone (as per specifications and together with specified accessories as provided on company website ‘www.jiophone.com’) on the terms and conditions herein contained. By applying for the JioPhone and affixing an electronic signature by way of biometric authentication, the Recipient accepts the JioPhone offer on the terms and conditions contained herein.

Security Deposit (a) An interest-free refundable security deposit of Rs. 1,500/- (Rupees One Thousand Five Hundred only) (“Refundable Deposit”) shall be deposited by the Recipient in the manner stipulated by the Company. (b) The Refundable Deposit is being obtained purely to secure the Company for proper handling of the JioPhone and its safe return by the Recipient to the Company, as per these terms. (c) Any amount deposited by the Recipient with the Company at the time of pre-booking shall be treated as part furnishing of the Refundable Deposit and the Recipient will be only required to deposit the balance amount. (d) The Recipient acknowledges and agrees that the Company shall, without prejudice to its rights and remedies under any law or in equity, have a right of lien over the Refundable Deposit for satisfaction of all the obligations herein, including any payment obligations, by the Recipient. (e) The Recipient acknowledges that it is not the intention of the parties to apply the Refundable Deposit towards consideration for any supply.

The adjustment of the Refundable Deposit shall only be to the extent and in the manner envisaged in these terms. Use of JioPhone (a) The JioPhone is only for the personal use of the Recipient and such use shall be in strict adherence with applicable laws and in accordance with guidelines/ stipulations issued from time to time by the Government or the Company for fair and authorized use. (b) The JioPhone is available for continued use on the Recipient purchasing telecom recharge vouchers of an Authorized Carrier (presently Reliance Jio Infocomm Limited) from the Company or any of its authorized retailers for use in the JioPhone of a minimum value of Rs. 1,500/- per annum for a period of 3 years from the date of the first issue of the JioPhone. (c) The Recipient has satisfied himself/herself/itself with the features of the JioPhone and has agreed to receive the JioPhone on “As-It-Is-Basis” and shall not tamper with or in any manner misuse the JioPhone, including but not limited to rooting attempts, reverse engineering, unlocking or jail-breaking of the JioPhone or original firmware(s) or software(s) of the JioPhone. (d) The Recipient is aware that JioPhone is being offered with a SIM-locked feature.

The Company may, solely at its discretion, allow the use of the JioPhone with any other compatible network from time to time. (e) The Recipient acknowledges that the Company has no responsibility for the actual provision of telecommunication services and that the Recipient is solely responsible for availing these services from the Authorized Carrier(s). (f) Nothing contained herein shall be construed as creating any arrangement for transfer of title, ownership or interest including rights of any intellectual property in/of the JioPhone in favour of the Recipient. (g) The Recipient has no right to sell, lease, assign, and transfer or otherwise dispose-of the JioPhone in any manner whatsoever. Early Return of the JioPhone (a) The Recipient may return the JioPhone at any time during the period of three years from the date of first issue on payment of the following charges (“Early Return Charges”): Time of Return of JioPhone Early Return Charges Upto 12 months from the date of first issue of the JioPhone Rs. 1,500/- (Rupees One Thousand Five Hundred only) plus applicable GST or other taxes After 12 months and up to 24 months from the date of first issue of the JioPhone Rs.

1,000/- (Rupees One Thousand only) plus applicable GST or other taxes After 24 months and up to 36 months from the date of first issue of the JioPhone Rs. 500/- (Rupees Five Hundred only) plus applicable GST or other taxes (b) On the Recipient complying with the Return Conditions as defined in Clause 6 below and paying the applicable Early Return Charges, the Company shall return the Refundable Deposit to the Recipient. Repossession of JioPhone (a) The Company has the right to repossess the JioPhone if the Recipient fails to purchase recharge vouchers as per Clause 2(b) above. (b) In the event the Company repossesses the JioPhone in terms of this clause, the Recipient shall be liable to pay the Early Return Charges in terms of Clause 3 herein above. (c) Whenever the Recipient pays the applicable Early Return Charges, the Company shall return the Refundable Deposit.

Warranty for use (a) The Company grants a limited warranty for use of the JioPhone in terms of the warranty conditions as available at ‘www.jiophone.com’. (b) The Company offers no warranty for third party hardware accessories whether authorized or not by the Company for use with the JioPhone. (c) Any repairs/replacement of parts of the JioPhone not covered by warranty may be carried out by the Company on payment of charges by the Recipient as stipulated by the Company from time to time. Return of JioPhone (a) The JioPhone shall be returned by the Recipient to the Company on or after the expiry of thirty six months but before the expiry of thirty nine months from the date of first issue of the JioPhone. Scope 1.1 Reliance Retail Limited and its affiliated companies (hereinafter referred to as “RRL”) are committed to protecting and respecting your privacy.

1.2 This policy, together with any additional terms and conditions that contain supplementary information in connection with your applying for and/or using the JioPhone and/or other stipulated RRL devices (this “Privacy Policy”), outline RRL’s privacy practices regarding the collection, use and safeguard of your information through RRL websites, devices, applications and any services, both online and offline. 1.3 The use, access or submission of personal information by you, or if you are a minor, the submission of your personal information either by your parents (or your guardian) or by you with the permission of your parents (or guardian) to RRL will be deemed as your acceptance of this Privacy Policy. Changes to Policy 2.1 We are obligated to protect your information in accordance with applicable laws, and regulations. 2.2 This Policy is subject to modification based on changes in the business, legal and regulatory requirements and will be updated online.

We will make all efforts to communicate any significant changes to this Policy to you. You are encouraged to periodically visit this page to review the Policy and any changes to it. Third Party Services 3.1 Please note that your mobile service provider, mobile operating system provider, third party applications (including the applications pre-loaded on the JioPhone and other stipulated RRL devices), social media platforms and websites that you access may also collect, use and share information about you and your usage. We cannot control how these third parties collect, use, share or secure this information.

For information about third-party privacy practices, please consult their respective privacy policies. Personal Information: 4.1 Personal information is defined as information that can be used to identify you and may include details such as your name, age, gender, contact information, products and services you are interested in or require more information about. Insofar as sensitive personal information is concerned, it will carry the meaning as may be defined by applicable laws from time to time. 4.2 You may at any time, opt-out of sharing the abovementioned personal information.

4.3 The following is the manner in which we collect, use, share and retain personal information. 4.3.1 Collection You agree that RRL, its licensees and agents may collect such personal information, whenever relevant, to help providing you with information on products and services. You also consent to the collection of certain personal information in the course of your applying for the products and/or services and during activation and validation for internet-based services. THIS LIMITED WARRANTY APPLIES TO YOUR USE OF JIOPHONE IN ACCORDANCE WITH THE TERMS AND CONDITIONS OF THE JIOPHONE OFFER AND IS SUBJECT TO (1) YOUR ADHERENCE THEREOF; AND (2) ALL GUIDELINES THAT RELIANCE RETAIL LIMITED MAY STIPULATE FROM TIME TO TIME; AND (3) THE TERMS AND CONDITIONS OF THIS LIMITED WARRANTY.

THE TERMS AND CONDITIONS OF THE JIOPHONE OFFER UNDER WHICH THE JIOPHONE IS MADE AVAILABLE MAY BE ACCESSED AT. BY USING THE JIOPHONE, YOU SIGNIFY THAT YOU HAVE READ, UNDERSTOOD AND AGREE TO BE BOUND BY THE TERMS AND CONDITIONS OF THIS WARRANTY.

Posted :